You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. Pichler I, Fuchsberger C, Platzer C et al. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18%[21] to 20%[22] of Kalash, approximately 16% of Brahui,[22] and approximately 11.5% of sampled Pashtun,[21] but in only about 3% of the general Pakistani population.
Haplogroup - an overview | ScienceDirect Topics Sengupta S, Zhivotovsky LA, King R et al. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. Population codes: Baltics (Blt), Belarusians (Blr), Poles (Pol), Ukrainians (Ukr), northern Russians (NRu), southern and central Russians (SRu), Circum-Uralic (CUr), Germans (Ger), Central Europeans (CE), Iberians (Ibr), French (Fra), Sardinians (Srd), Corsica (Cor), Sicilians (Sic), Italians (Ita), Switzerlands (Swi), Western Balkans (WB), Romanians (Rmn), Bulgarians (Bul), Crete (Crt), Greeks (Grc), Anatolian Greeks (AG), Egyptians (Egy), Near/Middle Easterners (ME), Ashkenazi Jews (AJ), Sephardic Jews (SJ), Arabian Peninsula (AP), Palestinians (Pal), Druze (Drz), Western Turks (WTu), Central Turks (CTu), Eastern Turks (ETu), Iranians (Irn), Abkhazians (Abh), Armenians (Arm), Georgians (Grg), South Ossetians (SOs), Iranian Azeris (Azr), Abazins (Aba), Adyghes (Ady), Balkars (Blk), Cherkessians (Crk), Kabardins (Kab), Karachays (Kar), Kuban Nogays (Nog), North Ossetians (NOs), Chamalals (Cha), Ingushes (Ing), Kumyks (Kum), Central Asians (CA), Pakistani (Pak). Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. [8][9], Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup.
Frontiers | The Geographic Origins of Ethnic Groups in the Indian Neolithic mitochondrial haplogroup H genomes and the genetic - Nature Kivisild T, Rootsi S, Metspalu M et al. Proc Natl Acad Sci USA 2011; 108: 97889791.
Y-DNA Haplogroup G-M201 - Marres G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran. Name: G-L14 Age: 7800 ybp 1700 CI 95% Expansion: 5200 ybp 1900 CI 95% Parent: G-L1 Note: This information does not imply an endorcement of YFull or their methods. ISSN 1476-5438 (online) Am J Hum Genet 2003; 72: 313332. Hg G is very frequent in NW Caucasus and South Caucasus, covering about 45% of the paternal lineages in both regions2 in this study. SD was also calculated for the age estimates according to the following formula: 25/1000 (ASD0 variance)/0.00069. Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. Although M527 frequency (Supplementary Table S1) is relatively low (16%), its phylogeographic distribution in regions such as southern Italy, Ukraine and the Levant (Druze and Palestinians) often coincides with areas associated with the Neolithic and post-Neolithic expansions into the Greek Aegean beginning approximately 7000 years ago.41 The expansion time (Td) of M527 is 71002300 years ago and is consistent with a Middle to Late Neolithic expansion of M527 in the Aegean. The hg G-U1 subclade is characterized by several sub-clusters of haplotypes, including a more diverse cluster mostly represented by Caucasus populations. The authors declare no conflict of interest. The most probably region of the initial phase of G-M201 is estimated to be in Anatolia, Armenia or western Iran. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. Int J Legal Med 1997; 110: 134149. The suggested relevant pre-historical climatic and archeological periods specified in conjunction with lineage-specific estimated expansion times are specified in the summary portion of Supplementary Table S4. Kharkov VN, Stepanov VA, Borinskaya SA et al. G1-M285, previously described in the Iranian population . While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. Princeton: Princeton University Press, 1994. The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001. The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided. Goncalves R, Freitas A, Branco M et al. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians). A separate study on the Argyns found that 71% of males belong to G1. The haplogroups contain many branches called subhaplogroups or subclades. His male-line descendants appear to remained rooted in the region for tens of thousands of years while the Ice Age was in full swing. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. In the northern and highland areas of the island of Sardinia off western Italy, G percentages reach 11% of the population in one study[17] and reached 21% in the town of Tempio in another study. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. PubMedGoogle Scholar. The identification of a new SNP can necessitate renaming of one or more categories. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. G-PF3147 (previously G-L223 and G-PF3146) is characterized by having the L223 mutation. Am J Hum Genet 2000; 67: 15261543. K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. Because M201 was identified first, it is the standard SNP test used when testing for G persons. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. PLoS One 2011; 6: e17548.
Haplogroup G-M285 - Wikipedia [23] About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. Nonetheless, our approach using high-resolution phylogenetic relationships as well as their phylogeography to infer the possible origin of a genetic variant provides a more plausible deduction than simply the region of highest frequency. Nonetheless, coalescent times provide a valuable/informative relative metric for estimating the time of lineage formation. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. P257 was first reported in 2008. Categories have alternating letters and numbers. Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ : Iran: tricontinental nexus for Y-chromosome driven migration. [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. Haplogroup G is observed in this survey as G1-M285 and G2a-P15. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. While neither knowledge of paleo-climate, archeology or genetic evidence from a single locus using modern populations provides an unimpeachable microcosm of pre-historical expansions, considering them together cautiously provides a contextual framework for discussion. Excavating Y-chromosome haplotype strata in Anatolia. AAL thanks the Sorenson Molecular Genealogy Foundation. [citation needed] Flores C, Maca-Meyer N, Gonzalez AM et al. In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", tzi. Conversely, hg G is present in Northeast Caucasus only at an average frequency of 5% (range 019%). The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. ), International Society of Genetic Genealogy, List of genetic results derived from historical figures, Y-chromosome haplogroups in populations of the world, Y-DNA haplogroups in populations of Europe, Y-DNA haplogroups in populations of the Caucasus, Y-DNA haplogroups in populations of the Near East, Y-DNA haplogroups in populations of North Africa, "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus", Atlas of the Human Journey: Haplogroup G (M201), "The Geographic Origins of Ethnic Groups in the Indian Subcontinent: Exploring Ancient Footprints with Y-DNA Haplogroups", "Late Pleistocene human genome suggests a local origin for the first farmers of central Anatolia", "Early farmers from across Europe directly descended from Neolithic Aegeans", "Ancient DNA suggests the leading role played by men in the Neolithic dissemination", "Ancient DNA from European Early Neolithic Farmers Reveals Their Near Eastern Affinities", "From surnames to the history of Y chromosomes: the Sardinian population as a paradigm", "Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau", "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe", "Y Chromosomal Evidence for a Limited Greek Contribution to the Pathan Population of Pakistan", "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists", "A prehistory of Indian Y chromosomes: Evaluating demic diffusion scenarios", "Dual Origins of the Japanese: Common Ground for Hunter-Gatherer and Farmer Y-Chromosomes", "Dissecting the influence of Neolithic demic diffusion on Indian Y-chromosome pool through J2-M172 haplogroup", "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan", "Chromosome Diversity Characterizes the Gulf of Oman", "The Druze: A Population Genetic Refugium of the Near East", "The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations", "Geographical Structure of the Y-Chromosomal Genetic Landscape of the Levant: A Coastal-Inland Contrast", "The place of the Basques in the European Y-chromosome diversity landscape", "A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes", "Kinship and Y-Chromosome Analysis of 7th Century Human Remains: Novel DNA Extraction and Typing Procedure for Ancient Material", "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula", http://ytree.ftdna.com/index.php?name=Draft&parent=20173662, "..Project Rosters - Haplogroup G Project", "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood", "Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events", "The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations", "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree", http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=L240;class=Sequence;ref=ChrY;start=3191153;end=3191153;feature_id=40369, "Improved Resolution Haplogroup G Phylogeny in the Y Chromosome, Revealed by a Set of Newly Characterized SNPs", "Identification of the remains of King Richard III", https://haplogroup.info/all-ancient-dna-full.xlsx, "Results from the Hamman Family Y-Chromosome DNA Tests", "Haplogroup G2a (Y-chromosomal DNA) - Eupedia", Y-DNA Haplogroup G and its subclades from the current year ISOGG haplotree. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). Gene pool structure of Eastern Ukrainians as inferred from the Y-chromosome haplogroups. The identities of the specific 19 loci that define the STR haplotypes are reported in Supplementary Table S3 and Figure 4 legend. The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Croat Med J 2005; 46: 502513. Distribution. It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. Am J Hum Genet 2004; 74: 788788. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68].
The genetic variation in the R1a clade among the Ashkenazi - Nature L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. Semino O, Magri C, Benuzzi G et al. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. Mol Biol Evol 2006; 23: 22682270. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. Eur J Hum Genet 2010; 18: 348353. Rosser ZH, Zerjal T, Hurles ME et al. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Zalloua PA, Xue Y, Khalife J et al. Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north. In the ten remaining populations, haplogroup diversity spanned from a low of 0.21 in Adyghes, to highs of 0.88 in Azeris (Iran) and 0.89 in eastern Anatolia and 0.90 in Armenia. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome.
Haplogroup G (Y-DNA) - Origins - LiquiSearch Google Scholar. In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated.